Restriction enzyme problem

Use this category for questions directly related to DNA manipulation (isolation, purification, sequencing, etc.) and questions regarding general PCR methodologies

Moderators: r.rosati, mchlbrmn

Re: Restriction enzyme problem

Postby lazyyan » Jun 12 2009 6:59 pm

i'm using 100bp from fermentas, yes i include both primers in NEB cutters. i dont think i using so much ladder, just 1 ul of ladder, for 100bp 1 ul marker+1ul ladder+5ul TBE, for RE i just put 1ul ladder+5ul of RE. i;m using 1.0% of agarose gel in 50ml, and i run 70v for 55- 60 minute.
lazyyan
supertech
supertech
 
Posts: 94
Joined: Sep 15 2008 11:52 am
Location: Malaysia

Re: Restriction enzyme problem

Postby lazyyan » Jun 12 2009 7:06 pm

Onyourcase wrote:
mpagel wrote:so, you would expect 3 fragments
155 (start to 155)
73 (155 to 243)
and 91 (243 to end)
assuming complete digestion. (partial digestion could give you a 228bp band and/or a 164bp band)

On the PCR picture, you have the 334 band above the 4th major band. So, what brand of 100bp ladder are you using? Otherwise, is there any chance that you have additional DNA flanking the gene, making a larger product, which would make the first (155bp band) and last (91 bp band) larger? In the top photo, if each band is 100bp and you don't have any bands that "ran off" the gel, I'd estimate the size of your PCR around 440bp. Assigning 50bp to each end would give 205 and 141bp bands in addition to the 73bp band.

Yes, so a couple of follow on questions What is the source of the ladder? and Did you remember to include the primers sites in the fragment you searched NEB cutter with? One comment I also have: For a PCR fragment your products are looking really weak on the gel pictures. I can't tell from the pictures but I think if you add much less ladder you will be able to expose for longer and bring up the bands better while still seeing the marker ladder. The gel we need to see has three lanes 1) known marker 2) uncut 3)mboII cut


i will do this later
lazyyan
supertech
supertech
 
Posts: 94
Joined: Sep 15 2008 11:52 am
Location: Malaysia

Re: Restriction enzyme problem

Postby lazyyan » Jun 14 2009 2:33 am

should i do Puried PCR product using clean up kit?
lazyyan
supertech
supertech
 
Posts: 94
Joined: Sep 15 2008 11:52 am
Location: Malaysia

Re: Restriction enzyme problem

Postby Onyourcase » Jun 14 2009 4:07 pm

lazyyan wrote:should i do Purified PCR product using clean up kit?

Always best to purify product before using a restriction enzyme.
Onyourcase
PI of Posters
PI of Posters
 
Posts: 399
Joined: Jul 26 2008 1:33 pm
Location: Norwich

Re: Restriction enzyme problem

Postby Onyourcase » Jun 14 2009 4:26 pm

lazyyan wrote:onurcase, here is my detail


from the gel pic the band was below 100bp and below 200 bp ?
Image

onyourcase: what do u mean "Sizing small fragments is not that accurate." izzit normal?


OK, if they are Fermentas markers then it suggests your original product is running slower than expected from your size estimate. As I quoted earlier mboII can make fragments run slower. In your digest you can see your original product, a fragment running just below 200bp (I think it's your biggest product from the digest and runs slower because of the mboII?) and I think the band just below 100bp is a doublet of the other two expected fragments
Onyourcase
PI of Posters
PI of Posters
 
Posts: 399
Joined: Jul 26 2008 1:33 pm
Location: Norwich

Re: Restriction enzyme problem

Postby mpagel » Jun 14 2009 6:28 pm

It has too many bands for GeneRuler 100bp from Fermentas, but seems to possibly have the proper number (14) for GeneRuler 100 bp Plus, or possibly O'RangeRuler 100 bp (with two of the lanes being merged). That being said, the faint band at the bottom would be the 100bp band, meaning that one band is at 300bp and the other just under 200bp.

Does the restriction enzyme really add that much weight? In any case, I would think that sequencing was in order.
Affiliations
Primary: Penn State Biochemistry, Microbiology and Molecular Biology
International Society of Molecular & Cellular Biology and BioTechnology Protocols and Research - officer and web contact
mpagel
PI of Posters
PI of Posters
 
Posts: 419
Joined: Nov 07 2006 3:08 pm

Re: Restriction enzyme problem

Postby Onyourcase » Jun 15 2009 7:42 am

mpagel wrote:It has too many bands for GeneRuler 100bp from Fermentas, but seems to possibly have the proper number (14) for GeneRuler 100 bp Plus, or possibly O'RangeRuler 100 bp (with two of the lanes being merged). That being said, the faint band at the bottom would be the 100bp band, meaning that one band is at 300bp and the other just under 200bp.

Does the restriction enzyme really add that much weight? In any case, I would think that sequencing was in order.

I agree too many bands but I think the faint band just running off the gel is 50bp, hence my suggestion of doublet just under 100bp and single just under 200. I don't know what's affecting mobility? Couple of things to remember 1) the sequencing will only read from where the sequencing primers bind and 2) It doesn't have to add the "weight" but could change the shape.
Onyourcase
PI of Posters
PI of Posters
 
Posts: 399
Joined: Jul 26 2008 1:33 pm
Location: Norwich

Re: Restriction enzyme problem

Postby mpagel » Jun 15 2009 5:51 pm

I wasn't able to find a Fermentas 100bp ladder that had a 50bp band though;) That was my initial reaction when I saw the photograph before Fermentas was mentioned though.

It always helps to include a product number, give a specific name of the product (not just the company) or provide a link to either the product information online or a photograph of the documentation that came with the product.

OYC: yeah, silly me forgot about changing the shape (or even charge shielding!) could affect migration. Is there a way to disassociate this endonuclease from the DNA prior to the gel run?
Affiliations
Primary: Penn State Biochemistry, Microbiology and Molecular Biology
International Society of Molecular & Cellular Biology and BioTechnology Protocols and Research - officer and web contact
mpagel
PI of Posters
PI of Posters
 
Posts: 419
Joined: Nov 07 2006 3:08 pm

Re: Restriction enzyme problem

Postby Onyourcase » Jun 15 2009 6:08 pm

mpagel wrote:I wasn't able to find a Fermentas 100bp ladder that had a 50bp band though;) That was my initial reaction when I saw the photograph before Fermentas was mentioned though.

It always helps to include a product number, give a specific name of the product (not just the company) or provide a link to either the product information online or a photograph of the documentation that came with the product.

OYC: yeah, silly me forgot about changing the shape (or even charge shielding!) could affect migration. Is there a way to disassociate this endonuclease from the DNA prior to the gel run?


They suggest "To avoid an atypical DNA band pattern, use the 6X Loading Dye & SDS Solution (#R1151) for sample preparation or heat the digested DNA in the presence of SDS prior to electrophoresis."

I actually couldn't find a ladder that matched but it might be a tube from the back of the freezer (in permafrost) "taken from Captain Oates cold dead hand" of some old product that's no longer made?
Onyourcase
PI of Posters
PI of Posters
 
Posts: 399
Joined: Jul 26 2008 1:33 pm
Location: Norwich

Re: Restriction enzyme problem

Postby lazyyan » Jun 16 2009 2:49 am

if i heat at 65C, the enzyme will be inactive right? what will be happen if the enzyme inactive? is it the enzyme will be disappear.. becourse some journal was used to inactive the enzyme after 3 hours incubate 37C for 10 min. i think this step are same, using R1151;the 6X Loading Dye & SDS Solution. According to R1151 protocol, they need heat at 65C for 10 min also.
lazyyan
supertech
supertech
 
Posts: 94
Joined: Sep 15 2008 11:52 am
Location: Malaysia

Re: Restriction enzyme problem

Postby relaxin » Jun 16 2009 8:25 am

Heating at 65 C for 10 min will heat denature most (but not all) proteins and inactivate most enzymes. The enzymes will not "disappear", they are just dead.
Retired academic researcher. Mention of a specific product does not imply my endorsement of the product. No conflict of interest or guarantee to work on the advice given. Do as I say, not as I do. Not liable to the loss of your valuable samples.
relaxin
PI of Posters
PI of Posters
 
Posts: 7187
Joined: Jan 11 2006 12:40 pm
Location: Mauna Kea

Re: Restriction enzyme problem

Postby mchlbrmn » Jun 16 2009 11:13 am

The NEB catalog says that heating MboII at 65C for 20 min will heat inactivate the enzyme. Heating, especially with SDS, could remove the enzyme from the DNA. NEB also mentions that they recommend not digesting MboII longer than 1 hour, so it's possible it tends toward nonspecific activity, although they don't mention star activity. I notice it's one of those non-palindromic enzymes. I remember when I once had trouble with FokI degrading my DNA, they told me not to use too much too long, that the enzyme didn't have much turn over anyway, and this fixed my degradation problem.
mchlbrmn
ModSquad
ModSquad
 
Posts: 3990
Joined: Dec 13 2005 1:03 pm
Location: Boston, USA

Re: Restriction enzyme problem

Postby lazyyan » Jun 16 2009 10:35 pm

Onyourcase wrote:
lazyyan wrote:onurcase, here is my detail


from the gel pic the band was below 100bp and below 200 bp ?
Image

onyourcase: what do u mean "Sizing small fragments is not that accurate." izzit normal?


OK, if they are Fermentas markers then it suggests your original product is running slower than expected from your size estimate. As I quoted earlier mboII can make fragments run slower. In your digest you can see your original product, a fragment running just below 200bp (I think it's your biggest product from the digest and runs slower because of the mboII?) and I think the band just below 100bp is a doublet of the other two expected fragments


hi admin and chatter,
when i think , i was started and try manual search for MBOII enyzme (gaaga) i found a new result.

this is my sequece,
AGCTCCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAATACACTACACGTCTGACATTA
CCACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGA
GCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG
AAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT
TCTGAGGGGCTGCA

and this my translation

tcgaggagtgactcctgagacaaattagcgtgtttaacagtgtcccgataaggagcgttatgtgatgtgcagactgtaatggtggcggaagagtaggcctcgggtgtagaccgctctgcagttaatgccaactgattagg
ctttggaggtgcggttgcctcggagaaagaagaaatagacgtaaataaaggtgtagcctgctcctgatatgatgccgaggatggatatatttctttgtactttgtagccccattaagaagaggatgatcaatat
tattggcggaaacatccaatacataatgggactcctgtttatagtaagactccccgacgt

where is the bold are MBO II enzyme will cutting (gaaga), base on translation above, the MBO II will cut at 87bp, 168bp and 256bp.
and base on NEBCUTTER the MBO will be cut at only 155bp and 243bp.

but i'm not sure whether my opion is right or not.. but i need some opion and suggest..
what do u think ?
lazyyan
supertech
supertech
 
Posts: 94
Joined: Sep 15 2008 11:52 am
Location: Malaysia

Re: Restriction enzyme problem

Postby mchlbrmn » Jun 17 2009 11:00 am

Sorry, I couldn't understand everything you said. However, if the recognition sequence is 5'-GAAGA-3' in the sequence, it WILL NOT cut 3'-GAAGA-5'. You cannot take the complement of a sequence without also reversing it to reflect the two complementary DNA strands being in opposite orientation.

The recognition site is (Both strands written out):

5'GAAGA3'
3'CTTCT5'

It will not cut:
5'CTTCT3'
3'GAAGA5'
even though it contains GAAGA (looked at backwards). The orientation of the DNA strand is essential to a restriction enzyme's recognition specificity. All computer programs you put a DNA sequence into assume you are giving a 5' to 3' strand orientation.
mchlbrmn
ModSquad
ModSquad
 
Posts: 3990
Joined: Dec 13 2005 1:03 pm
Location: Boston, USA

Re: Restriction enzyme problem

Postby mpagel » Jun 17 2009 3:04 pm

My First Point
but it WILL cut 5'-TCTTC-3'

My Second Point
you say "this is my sequece",
"and this my translation"

you mean that the second is a "complement" (not transcription and even less so translation).

One thing you may be missing on is that gene sequences are often given from the perspective of the coding strand, which is the non-template strand. The template strand (5'-3') is complimentary to the "coding strand" is the actual thing used (3'-5') to start your mRNA strand (5'-3') which is complimentary to the template, with the exception of uracils substituting for thymidines. So, essentially the "transcription" is the same as your coding strand (with Us for Ts), which is often what people discuss when they're talking about their gene.

So, your coding strand might read (in frame) as
5'-ATGAAAGGGTTTCCC-3'
The template strand is
3'-TACTTTCCCAAAGGG-5'
the mRNA produced would look like
5'-AUGAAAGGGUUUGGG-3'
the protein produced would start with a methonine. Beyond that I don't have my codon table memorized, so I leave it up to you to tell me what the protein produced would be. I'll give you a hint: it's 5 amino acids long.
Affiliations
Primary: Penn State Biochemistry, Microbiology and Molecular Biology
International Society of Molecular & Cellular Biology and BioTechnology Protocols and Research - officer and web contact
mpagel
PI of Posters
PI of Posters
 
Posts: 419
Joined: Nov 07 2006 3:08 pm

PreviousNext

Return to DNA and General PCR Methods

Who is online

Users browsing this forum: No registered users and 1 guest