designing GFP primers for Arabidopsis

[athalianaovule]

Hi, I am new here, and I would like some help/advice in designing primers for GFP in Arabidopsis GFP marker lines. I want to design a "universal" primer that would recognize the GFP sequence so that I can PCR genotype my plants that have been crossed with the marker. I know that I can technically use a selectable marker (kanamycin or basta) to identify the plants that are positive for GFP - but I would rather PCR genotype for the marker and my fellow lab mates have expressed interest in using the primers I should be designing for their own work. I've looked at several papers (that deal with PCR genotyping for GFP marker lines in Arabidopsis) that have provided the GFP primer sequence that was used - but there seems to be no consensus sequence between the papers and I am now confused as to how to go about designing primers for just GFP. Any feedback would be appreciated.

[mchlbrmn]

There is no reason many different good primer sets can't be designed for GFP. You can check the primers you researched to make sure they match GFP sequence if you are not sure what they are for. It's best to use primers where they show actual results, and give PCR conditions (a primer may be excellent in one set of conditions, but not work in other condtions).

Here are some primers I designed for eGFP (enhanced, some mutations different from old GFP, I'm not sure if they are in the primer region) [Edit: I checked. The primer sequence is different for original GFP.]
Forward: TTCTTCAAGGACGACGGCAA
Rev: TCGATGTTGTGGCGGATCTT
221 bp product.
Used in Roche LightCycler SYBR mix.
95C 10 minutes.
Cycle: 10", 6", 15"; 95c, 63-60C(Touchdown. Delay 6 cycles at 63C, then -0.5/cycle until 60C.), 72C
Melt curve program.
(This is a touchdown program. It worked OK at 60C anneal (no touchdown) but didn't look as perfect. Probably would work better at single anneal temp 61, 62 or 63C, but I haven't tried it.)